| Detail of Probeset Mtr.25196.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.25196.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | 1797.m00031 /FEA=mRNA /DEF=CR932958.1 52456 51859 mth2-174i23 homologue to UP|GRPA_MEDFA (Q09134) Abscisic acid and environmental stress inducible protein |
| Mapped public sequence ID | 1797.m00031 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42571 BQ154211 BQ144209 |
| Target sequence | atttcttcagaagtctcagccagggacttaactgaaactacctctgatgccaaaaaggaa |