Detail of Probeset Mtr.25423.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.25423.1.S1_at
Species Medicago truncatula
Annotation 1416.m00052 /FEA=mRNA /DEF=AC124963.32 79387 74571 mth2-24f5 weakly similar to TIGR_Ath1|At3g09720-GOpep .1 68410.m01034 DEAD/DEAH box helicase, putative similar to RNA helicase involved, complete
Mapped public sequence ID 1416.m00052
Gene Ontology GO:0003676 GO:0003724 GO:0005524 GO:0005575 GO:0006364 GO:0008026 GO:0008150 GO:0016887
KEGG K01529
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence taaaacatgggttttgattgccactgacgtggttgctcggggaatggatttcaaaggcat
aaactgtgtgatcaattatgatttcccagattctgcatctgcatatatccacagaattgg
tcgttctggcagagcag