| Detail of Probeset Mtr.25469.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.25469.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1418.m00053 /FEA=mRNA /DEF=AC126781.22 109137 109444 mth2-12m15 homologue to UP|Q67WC8 (Q67WC8) Putative transport protein SEC61, complete |
| Mapped public sequence ID |
1418.m00053 |
| Gene Ontology |
GO:0005784 GO:0006616 GO:0008565 GO:0015031 GO:0030176 |
| KEGG |
K07342 |
| Transporter |
3.A.5 3.A.5.9.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT49913 |
| Target sequence |
gctaaggacagcgtaaggctcgtcaagcgatgccacaaacccgatcgcaaagaattctct
aaggttgctgtgcgcactgccatcggtttcgttgtgatgggattcgttggctttttcgtt
aagctcattttcatcccaattaacaacatcatcg |