| Detail of Probeset Mtr.25641.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.25641.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1444.m00039 /FEA=mRNA /DEF=AC146630.25 68544 67678 mth2-7f22 weakly similar to TIGR_Ath1|At5g22250-GOpep .1 68412.m02373 CCR4-associated factor-related protein, partial (94%) |
| Mapped public sequence ID |
1444.m00039 |
| Gene Ontology |
GO:0000289 GO:0003674 GO:0005634 GO:0005737 GO:0006357 GO:0007517 GO:0016251 GO:0048666 |
| KEGG |
K17222 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT48755 |
| Target sequence |
gattcagattgggttaactctttctgatcataaaggtaatcttccaacgttagatactga
aaatagttatatttgggagtttaattttaaggattttgatgtggcgcgtgatgatcatgc
tgctgattctgttgagttgttgaggagacaagggattgattttgagaagaatcgtgagtg
cgggattgattctgttaa |
