Detail of Probeset Mtr.25706.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.25706.1.S1_at |
Species |
Medicago truncatula |
Annotation |
1449.m00036 /FEA=mRNA /DEF=AC146854.19 57755 53664 mth2-10i14 weakly similar to TAIR|gene:3688454-GOpep .1 68408.m07944 expressed protein |
Mapped public sequence ID |
1449.m00036 |
Gene Ontology |
GO:0003677 GO:0003910 GO:0004674 GO:0004683 GO:0004687 GO:0005200 GO:0005524 GO:0005634 GO:0006260 GO:0006281 GO:0006310 GO:0006468 |
KEGG |
K10747 K22102 |
Transporter |
1.A.4 3.A.8 1.A.4.1.1 3.A.8.1.1 |
Transcription Factor |
CCAAT-HAP3 MYB |
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
tcttttccacaaaaattggttctgcaaatgggctccatag |