Detail of Probeset Mtr.25964.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.25964.1.S1_s_at
Species Medicago truncatula
Annotation 1473.m00038 /FEA=mRNA /DEF=AC149809.10 27301 27633 mth2-154h8
Mapped public sequence ID 1473.m00038
Gene Ontology GO:0004221 GO:0004843 GO:0005575 GO:0005634 GO:0005737 GO:0006511 GO:0008022 GO:0016579 GO:0005515 GO:0005912 GO:0007163 GO:0015031 GO:0017016 GO:0045108 GO:0006508 GO:0004672 GO:0006468 GO:0019236 GO:0004497 GO:0005506 GO:0008150 GO:0020037 GO:0000027 GO:0000055 GO:0003723 GO:0005829 GO:0022625 GO:0042254 GO:0043023 GO:0016564 GO:0045892 GO:0042802
KEGG K00517 K01072 K01342 K01362 K01768 K06685 K07562 K08282 K08286 K09264 K11446 K15001 K18599 K19402
Transporter
Transcription Factor WRKY JUMONJI MADS
Mapped unigene in the TRICHOME database EX528024  BG451046  
TCMT61886  ES612112  
ES612558  ES611748  
Target sequence tttgagggttgattcaccttgggaaacactattagg