Detail of Probeset Mtr.26005.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.26005.1.S1_at
Species Medicago truncatula
Annotation 1478.m00030 /FEA=mRNA /DEF=AC150440.3 42048 36557 mth2-189e2 weakly similar to UP|O80828 (O80828) Hypothetical protein At2g45910
Mapped public sequence ID 1478.m00030
Gene Ontology GO:0005515 GO:0005634 GO:0005737 GO:0005829 GO:0007249
KEGG K00924 K04730 K04733
Transporter 1.A.26 1.A.26.1.1
Transcription Factor WRKY
Mapped unigene in the TRICHOME database N/A
Target sequence ccaaagggaacttttgtctacatggatcctgaattccttgcttccggtgaactcactccg
aaatcagatg