| Detail of Probeset Mtr.26052.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.26052.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1482.m00036 /FEA=mRNA /DEF=AC150446.8 44626 45841 mth2-101n14 similar to GOA_SPTR|O82232-GOpep Hypothetical UPF0057 protein At2g24040 |
| Mapped public sequence ID | 1482.m00036 |
| Gene Ontology | GO:0000329 GO:0003674 GO:0005737 GO:0005886 GO:0006812 GO:0008150 GO:0030003 GO:0033554 GO:0042391 GO:0043157 |
| KEGG | |
| Transporter | 9.B.12.1.1 9.B.12.2.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO514291 TCMT42759 BQ147784 |
| Target sequence | atgccttcacgttgtgaaatttgctgtgagattatgatcgctgtcttgctccctcctttg |