| Detail of Probeset Mtr.26064.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.26064.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1483.m00032 /FEA=mRNA /DEF=AC150706.4 19505 18225 mth2-132l18 similar to TIGR_Ath1|At1g55270-GOpep .1 68408.m05789 Kelch repeat containing F-box protein family similar to SKP1, partial (94%) |
| Mapped public sequence ID |
1483.m00032 |
| Gene Ontology |
GO:0001725 GO:0003779 GO:0005938 GO:0007297 GO:0007300 GO:0007301 GO:0007303 GO:0007349 GO:0030036 GO:0030717 GO:0030723 GO:0035183 GO:0042803 GO:0045172 GO:0048477 |
| KEGG |
K10443 K10458 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
aaagaactcttcgatctgctgaggtttacgaccctaatcggaacaggtggagctttatct
cggagatgaccacagctatggttccttttattggtgttattcataatgggacatggtttt
tgaaggggctcgggtcaaatcgcaatgtcatctgtgaagcctattcacaggaatctgata
cctggactccagta |