| Detail of Probeset Mtr.26068.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.26068.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1483.m00038 /FEA=mRNA /DEF=AC150706.4 45593 47047 mth2-132l18 weakly similar to TAIR|gene:2086793-GOpep .1 68410.m01536 expressed protein contains similarity to transporter proteins, partial (92%) |
| Mapped public sequence ID |
1483.m00038 |
| Gene Ontology |
GO:0006865 |
| KEGG |
K01552 K03294 |
| Transporter |
2.A.3 2.A.3.6 2.A.3.12.1 2.A.3.6.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gtttatgtgatgactgttgctaccaaaattgtatttgtggctagtactttcttaacattc
ttagggatagtgttgtattatttcatgaatctttgtaagtctaagaggtggattgaattc
agtggagtaggagat |