| Detail of Probeset Mtr.26158.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.26158.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1489.m00049 /FEA=mRNA /DEF=AC151527.13 49984 49328 mth2-135i19 weakly similar to UP|Q40477 (Q40477) Ethylene-responsive element binding protein |
| Mapped public sequence ID | 1489.m00049 |
| Gene Ontology | |
| KEGG | K09286 |
| Transporter | |
| Transcription Factor | AP2-EREBP |
| Mapped unigene in the TRICHOME database | TCMS40556 TCMT40890 |
| Target sequence | cgagattcactttcgcggcgtaagaaagcgaccatggggccgttacgccgccgagattcg |