| Detail of Probeset Mtr.26377.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.26377.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1507.m00065 /FEA=mRNA /DEF=AC155282.1 77972 78470 mth2-63e12 weakly similar to TAIR|gene:3434979-GOpep .1 68408.m02025 terminal Flower 1 (TFL1) -related similar to terminal Flower 1 |
| Mapped public sequence ID | 1507.m00065 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ccatatatagaaccaaagccaccagtgggtatccaccgatacatattggttttgtttgag |