| Detail of Probeset Mtr.26648.1.S1_a_at in Chip AffyMedicago |
| Probeset ID |
Mtr.26648.1.S1_a_at |
| Species |
Medicago truncatula |
| Annotation |
1549.m00072 /FEA=mRNA /DEF=AC151598.2 124200 132164 mte1-49g8 weakly similar to TAIR|gene:2009609-GOpep .1 68408.m05543 F-box containing tubby family protein similar to Tubby related |
| Mapped public sequence ID |
1549.m00072 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0005634 GO:0005737 GO:0005829 GO:0007602 GO:0007605 GO:0008020 GO:0009725 GO:0005515 GO:0007399 |
| KEGG |
K09448 K20975 |
| Transporter |
|
| Transcription Factor |
TLP |
| Mapped unigene in the TRICHOME database |
TCMT50706 |
| Target sequence |
gtgaagaactttcagctggttgctactgtggaccaaagccaacc |