| Detail of Probeset Mtr.26709.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.26709.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1555.m00041 /FEA=mRNA /DEF=AC152406.8 93062 92246 mth2-71o20 weakly similar to TAIR|gene:2129095-GOpep .1 68411.m02382 expressed protein |
| Mapped public sequence ID |
1555.m00041 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0005829 GO:0060027 |
| KEGG |
K20666 K25835 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
DW018466 |
| Target sequence |
gggagtagatagtgctgcgtcttctagctccaattcatggtcacataatgatgaagatga
taacagtagcaaaaacaacagcagtattgtggtgttgaatgtctatgatcttacccctat
taataattacatgtattggtttggatttggaatctttcactccggcattgaag |
