| Detail of Probeset Mtr.26879.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.26879.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL365768 /FEA=mRNA /DEF= |
| Mapped public sequence ID | AL365768 |
| Gene Ontology | GO:0003677 GO:0003785 GO:0005634 GO:0005737 GO:0006357 GO:0015629 GO:0015630 GO:0043565 GO:0051015 |
| KEGG | K09355 K17831 K22581 |
| Transporter | |
| Transcription Factor | HB |
| Mapped unigene in the TRICHOME database | AL365768 BI265328 |
| Target sequence | ggattcataattctctattgcacctctgcttgctctggtaatcttccccacctccgaaaa |