| Detail of Probeset Mtr.26881.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.26881.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL365936 /FEA=mRNA /DEF= |
| Mapped public sequence ID | AL365936 |
| Gene Ontology | GO:0003674 GO:0005575 GO:0008150 GO:0042600 GO:0040011 |
| KEGG | K00503 K03006 K04574 K06670 K17612 K17614 K24221 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | AL365936 AA660334 AA660523 |
| Target sequence | aaccccacaaaacctgactatgaagttcccaaatccaaaattgattatgggtatgcctcg |