| Detail of Probeset Mtr.27324.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.27324.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AW773738 /FEA=mRNA /DEF=homologue to PIR|S71223|S71223 xyloglucan endo-1,4-beta-D-glucanase XTR-4 - Arabidopsis thaliana (fragment) {Arabidopsis thaliana;} , partial (8%) |
| Mapped public sequence ID | AW773738 |
| Gene Ontology | GO:0005619 GO:0006112 GO:0016810 GO:0030476 GO:0007047 GO:0009277 GO:0009986 GO:0030445 GO:0030446 |
| KEGG | K08235 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40724 TCMT55855 AW773738 AW689648 EX526915 |
| Target sequence | acaaactcagctttcgaccttgcaaccatacccttcaacgatggttattctcatctcttt |