Detail of Probeset Mtr.27562.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.27562.1.S1_s_at
Species Medicago truncatula
Annotation BE204995 /FEA=mRNA /DEF=similar to UP|Q9SP26 (Q9SP26) P72 DEAD box protein, partial (9%)
Mapped public sequence ID BE204995
Gene Ontology GO:0000184 GO:0003724 GO:0004004 GO:0005524 GO:0005634 GO:0005730 GO:0005737 GO:0005739 GO:0005829 GO:0006364 GO:0008186 GO:0016462 GO:0016817 GO:0016818 GO:0016887 GO:0017111
KEGG K01509 K01529
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT46598  BE204995  
Target sequence gtcatgagatcactgttactggagataatgtgcctccccctgctacatcatttgcgtctt
ctggttttccatcggagattcttagagaggtacaaaatgctggggtattagcccccacgc
caattcaggcacaatcgtggcccattgcact