| Detail of Probeset Mtr.27600.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.27600.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
BE239968 /FEA=mRNA /DEF=homologue to UP|TCTP_MEDSA (P28014) Translationally controlled tumor protein homolog (TCTP), partial (58%) |
| Mapped public sequence ID |
BE239968 |
| Gene Ontology |
GO:0003674 GO:0005509 GO:0005515 GO:0005615 GO:0005737 GO:0005739 GO:0005771 GO:0005829 GO:0005840 GO:0006412 GO:0006916 GO:0006979 GO:0007283 GO:0008283 GO:0045298 |
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BE239968 |
| Target sequence |
tattcagacttcaggtcaggacagtcaaacacctctttatatccttagatgatacagttt
taatttatttttttgagctcgccactttcagaggttaattattttgttatgtgttgactg
ttataggaacaaccatct |
