| Detail of Probeset Mtr.27917.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.27917.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | BF520019 /FEA=mRNA /DEF=similar to GB|AAM62838.1|21553745|AY085617 Yippee-like protein {Arabidopsis thaliana;} , partial (19%) |
| Mapped public sequence ID | BF520019 |
| Gene Ontology | GO:0003674 GO:0005575 GO:0008150 |
| KEGG | K01802 K20038 K25643 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO515854 BF635599 TCMT58148 DW015758 BF520019 |
| Target sequence | atcaggtcctgatggtagcaattatcggatcaacaatggagcacatgttggcggaagcga |