| Detail of Probeset Mtr.28100.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.28100.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BG581966 /FEA=mRNA /DEF=similar to UP|Q9ZR44 (Q9ZR44) MtN9 protein (Fragment), partial (53%) |
| Mapped public sequence ID |
BG581966 |
| Gene Ontology |
GO:0004222 GO:0005578 GO:0006508 GO:0001501 GO:0005515 GO:0008233 GO:0030198 GO:0030574 GO:0043065 |
| KEGG |
K01417 K07761 K07763 K08004 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BG581966 |
| Target sequence |
gttttgcttttgtagctctcgtgaacttggcttcctaattaatatatcatttgattaggg
actcactttaatatccattggagtgcaaaaatcacttcaactagactttcgacctatcga
ctataataaagacca |
