| Detail of Probeset Mtr.28788.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.28788.1.S1_at |
| Species | Medicago truncatula |
| Annotation | BM813592 /FEA=mRNA /DEF=similar to UP|Q9XH38 (Q9XH38) Homeodomain leucine zipper protein, partial (59%) |
| Mapped public sequence ID | BM813592 |
| Gene Ontology | GO:0003700 GO:0005634 GO:0040010 GO:0043282 GO:0045449 GO:0045944 GO:0048813 |
| KEGG | K09338 |
| Transporter | |
| Transcription Factor | HB |
| Mapped unigene in the TRICHOME database | GE345329 |
| Target sequence | tgcgtctaacaaaggaacagtcccatctccttgaagaaagct |