Detail of Probeset Mtr.28788.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.28788.1.S1_at |
Species |
Medicago truncatula |
Annotation |
BM813592 /FEA=mRNA /DEF=similar to UP|Q9XH38 (Q9XH38) Homeodomain leucine zipper protein, partial (59%) |
Mapped public sequence ID |
BM813592 |
Gene Ontology |
GO:0003700 GO:0005634 GO:0040010 GO:0043282 GO:0045449 GO:0045944 GO:0048813 |
KEGG |
K09338 |
Transporter |
|
Transcription Factor |
HB |
Mapped unigene in the TRICHOME database |
GE345329 |
Target sequence |
tgcgtctaacaaaggaacagtcccatctccttgaagaaagct |