| Detail of Probeset Mtr.29501.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.29501.1.S1_at |
| Species | Medicago truncatula |
| Annotation | NP856176 /FEA=mRNA /DEF=GB|AY387709.1|AAQ84044.1 TMV N disease resistance protein-like Mtg1957 protein [Medicago truncatula] |
| Mapped public sequence ID | NP856176 |
| Gene Ontology | GO:0007265 GO:0017016 |
| KEGG | K06685 K10641 K11454 |
| Transporter | |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | AY387709 |
| Target sequence | gaaaatttttgcagtgtcctcgaatttaattgaaaacttggatttaagcagtacaggaat |