Detail of Probeset Mtr.29832.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.29832.1.S1_at
Species Medicago truncatula
Annotation AW256676 /FEA=mRNA /DEF=similar to GB|AAR24666.1|38603842|BT010888 At1g12740 {Arabidopsis thaliana;} , partial (30%)
Mapped public sequence ID AW256676
Gene Ontology GO:0001568 GO:0001709 GO:0001756 GO:0001972 GO:0007140 GO:0007283 GO:0008401 GO:0009954 GO:0021661 GO:0021797 GO:0030326 GO:0030902 GO:0034653 GO:0042221 GO:0042573 GO:0042574 GO:0048384 GO:0048854
KEGG K09587 K09588 K09590
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database AW256676  
Target sequence gacaatcccttggtgccttccggaagattcctggaactatatttgcaagtcttgcagttt
cggttatgagctgaaatgtaaag