| Detail of Probeset Mtr.30113.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.30113.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BE942346 /FEA=mRNA /DEF=UP|Q35042 (Q35042) Cytochrome oxidase subunit 1 (Fragment) , partial (23%) |
| Mapped public sequence ID |
BE942346 |
| Gene Ontology |
GO:0003674 GO:0004129 GO:0005515 GO:0005739 GO:0006123 GO:0006979 GO:0007568 GO:0021549 GO:0046688 GO:0051602 |
| KEGG |
K02256 |
| Transporter |
3.D.4 3.D.4.7.1 3.D.4.8.1 3.D.4.6.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BE942346 |
| Target sequence |
gggcccctctctcataaggaaggaaacgaaagaatctccattttatgacaaatccggtcc
gatggctgttctccactaaccacaaggat |
