Detail of Probeset Mtr.30883.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.30883.1.S1_at
Species Medicago truncatula
Annotation CB893526 /FEA=mRNA /DEF=similar to UP|O49460 (O49460) Prohibitin-like protein (Prohibitin 1), partial (15%)
Mapped public sequence ID CB893526
Gene Ontology GO:0000001 GO:0001302 GO:0003674 GO:0005739 GO:0005743 GO:0006457 GO:0008150 GO:0045861 GO:0003871 GO:0005634 GO:0005737 GO:0005829 GO:0009086 GO:0046084
KEGG K00549 K18842 K20926 K24235
Transporter 8.A.21.2.1
Transcription Factor
Mapped unigene in the TRICHOME database CB893526  TCMT46583  
Target sequence ggcttgtccgatcagttgggcacttttagcctcaccctgtgctcttgttactgcacttct
cttttcttgctcagctttttccaccacctgtttagccctctcagcttcttgtgcag