Detail of Probeset Mtr.30883.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.30883.1.S1_at |
Species |
Medicago truncatula |
Annotation |
CB893526 /FEA=mRNA /DEF=similar to UP|O49460 (O49460) Prohibitin-like protein (Prohibitin 1), partial (15%) |
Mapped public sequence ID |
CB893526 |
Gene Ontology |
GO:0000001 GO:0001302 GO:0003674 GO:0005739 GO:0005743 GO:0006457 GO:0008150 GO:0045861 GO:0003871 GO:0005634 GO:0005737 GO:0005829 GO:0009086 GO:0046084 |
KEGG |
K00549 K18842 K20926 K24235 |
Transporter |
8.A.21.2.1 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
CB893526 TCMT46583
|
Target sequence |
ggcttgtccgatcagttgggcacttttagcctcaccctgtgctcttgttactgcacttct
cttttcttgctcagctttttccaccacctgtttagccctctcagcttcttgtgcag |