Detail of Probeset Mtr.3091.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.3091.1.S1_at |
Species |
Medicago truncatula |
Annotation |
CB894531 /FEA=mRNA /DEF=homologue to UP|Q7XJP0 (Q7XJP0) SNF2/SWI2 family global transcription factor, partial (3%) |
Mapped public sequence ID |
CB894531 |
Gene Ontology |
GO:0003677 GO:0004386 GO:0004842 GO:0005515 GO:0005524 GO:0005575 GO:0005634 GO:0006281 GO:0006338 GO:0008094 GO:0008150 GO:0008270 GO:0016567 GO:0016585 |
KEGG |
K01509 K01529 K17274 |
Transporter |
|
Transcription Factor |
PHD |
Mapped unigene in the TRICHOME database |
CB894531 |
Target sequence |
gaacatgccgtttgccaccaacaacatcactttcgtccggatgaagggaggcaggaaagc
acacactgccataagtcaatttagaggaatacagaatggcacaaaaggat |