Detail of Probeset Mtr.3091.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.3091.1.S1_at
Species Medicago truncatula
Annotation CB894531 /FEA=mRNA /DEF=homologue to UP|Q7XJP0 (Q7XJP0) SNF2/SWI2 family global transcription factor, partial (3%)
Mapped public sequence ID CB894531
Gene Ontology GO:0003677 GO:0004386 GO:0004842 GO:0005515 GO:0005524 GO:0005575 GO:0005634 GO:0006281 GO:0006338 GO:0008094 GO:0008150 GO:0008270 GO:0016567 GO:0016585
KEGG K01509 K01529 K17274
Transporter
Transcription Factor PHD
Mapped unigene in the TRICHOME database CB894531  
Target sequence gaacatgccgtttgccaccaacaacatcactttcgtccggatgaagggaggcaggaaagc
acacactgccataagtcaatttagaggaatacagaatggcacaaaaggat