| Detail of Probeset Mtr.31050.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31050.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AA660238 /FEA=mRNA /DEF=similar to UP|BIOB_ARATH (P54967) Biotin synthase (Biotin synthetase) , partial (6%) |
| Mapped public sequence ID |
AA660238 |
| Gene Ontology |
GO:0004076 GO:0005739 GO:0006417 GO:0006766 GO:0009102 GO:0009451 GO:0018193 |
| KEGG |
K01012 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AA660238 TCMT41142
|
| Target sequence |
ctatgattctcccattcttgatcttctcttccacgggg |
