| Detail of Probeset Mtr.3110.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.3110.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
CB895124 /FEA=mRNA /DEF=similar to UP|Q69SJ3 (Q69SJ3) Clathrin assembly protein AP180 short form-like, partial (41%) |
| Mapped public sequence ID |
CB895124 |
| Gene Ontology |
GO:0005545 GO:0005905 GO:0006898 GO:0007268 GO:0007269 GO:0007270 GO:0008021 GO:0016183 GO:0030131 GO:0030276 GO:0042331 GO:0048488 GO:0048489 GO:0042734 |
| KEGG |
K14525 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT55969 |
| Target sequence |
gttattggttgccaggtgagcttttgatccaactggtttgaattaaatgaacaaaattta
taatgccagcagcattaatatcgtaccaattgtttttaacctttgtatgctgcagccaca
aggagca |