Detail of Probeset Mtr.31121.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.31121.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
AJ388903 /FEA=mRNA /DEF=UP|Q9AR91 (Q9AR91) Nodulin 25 (Fragment), partial (22%) |
Mapped public sequence ID |
AJ388903 |
Gene Ontology |
GO:0000275 GO:0001525 GO:0005509 GO:0005515 GO:0005524 GO:0005739 GO:0005743 GO:0005753 GO:0005759 GO:0005886 GO:0006172 GO:0006200 GO:0006629 GO:0006898 GO:0006933 GO:0009986 GO:0015992 GO:0016887 GO:0030228 GO:0042288 GO:0043499 GO:0045261 GO:0046034 GO:0046961 GO:0051453 |
KEGG |
K02133 |
Transporter |
3.A.2 3.A.2.1.2 3.A.2.1.3 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT48075 BG583037
TCMT40032 TCMT40162
AW574273 TCMT42513
|
Target sequence |
agttgattggaggactttccatgcaaaatacccttggataaaaaagaatgatcctaacac
tgttaccggaagccgaaaattactcaatgatattg |