Detail of Probeset Mtr.31121.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.31121.1.S1_s_at
Species Medicago truncatula
Annotation AJ388903 /FEA=mRNA /DEF=UP|Q9AR91 (Q9AR91) Nodulin 25 (Fragment), partial (22%)
Mapped public sequence ID AJ388903
Gene Ontology GO:0000275 GO:0001525 GO:0005509 GO:0005515 GO:0005524 GO:0005739 GO:0005743 GO:0005753 GO:0005759 GO:0005886 GO:0006172 GO:0006200 GO:0006629 GO:0006898 GO:0006933 GO:0009986 GO:0015992 GO:0016887 GO:0030228 GO:0042288 GO:0043499 GO:0045261 GO:0046034 GO:0046961 GO:0051453
KEGG K02133
Transporter 3.A.2 3.A.2.1.2 3.A.2.1.3
Transcription Factor
Mapped unigene in the TRICHOME database TCMT48075  BG583037  
TCMT40032  TCMT40162  
AW574273  TCMT42513  
Target sequence agttgattggaggactttccatgcaaaatacccttggataaaaaagaatgatcctaacac
tgttaccggaagccgaaaattactcaatgatattg