| Detail of Probeset Mtr.31123.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31123.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
AJ388912 /FEA=mRNA /DEF=similar to UP|Q9SYP1 (Q9SYP1) F9H16.5 protein, partial (3%) |
| Mapped public sequence ID |
AJ388912 |
| Gene Ontology |
GO:0000354 GO:0000381 GO:0000398 GO:0003724 GO:0004004 GO:0005515 GO:0005524 GO:0005634 GO:0005681 GO:0005682 GO:0008026 GO:0008380 GO:0030532 GO:0003676 |
| KEGG |
K01529 |
| Transporter |
3.A.5 3.A.5.9.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT55318 |
| Target sequence |
aaatctaagggtttccatcaatggcgcatctcggtggtggcgctgaagcccacgcacgtt
tcaaacaatacgaataccgtgcaaattccagtctagttcttactaccgattcacgtcccc
gcgacactcacgaacccaccggagaacccgaatctctctggggaagaattgatgctaaaa
acttcggtgaccgtgtttcccatgaccggccaccggag |
