Detail of Probeset Mtr.312.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.312.1.S1_s_at
Species Medicago truncatula
Annotation 1808.m00042 /FEA=mRNA /DEF=CR933104.1 17932 16245 mth2-25b3 homologue to TIGR_Ath1|At3g22630-GOpep .1 68410.m02595 20S proteasome beta subunit D (PBD1) identical to GB:CAA74026, partial (45%)
Mapped public sequence ID 1808.m00042
Gene Ontology GO:0003674 GO:0004175 GO:0005575 GO:0005634 GO:0005737 GO:0005839 GO:0006508 GO:0006511 GO:0008233 GO:0010243 GO:0014070 GO:0031145 GO:0051436 GO:0051437
KEGG K02734
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT43213  
Target sequence atggagtgcgttttcggattagttggtaatggtttcgcaatcgtggtggctgatacatcg
gcggttcacagcatcctcgttcacaaatccaacgaagacaagatcatgttcctcgattca
cacaaactcatcgctgctagcggtgaacccgg