| Detail of Probeset Mtr.31293.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31293.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AJ502357 /FEA=mRNA /DEF=similar to UP|Q6C356 (Q6C356) Yarrowia lipolytica chromosome F of strain CLIB99 of Yarrowia lipolytica, partial (9%) |
| Mapped public sequence ID |
AJ502357 |
| Gene Ontology |
GO:0003747 GO:0005575 GO:0005737 GO:0005829 GO:0006415 GO:0006605 GO:0007224 GO:0008079 GO:0018444 GO:0035071 GO:0048102 GO:0000003 GO:0002119 GO:0009792 GO:0040007 GO:0040011 |
| KEGG |
K03265 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AJ502357 |
| Target sequence |
atggttgatgttcatcatactgataagctccaggaatctgaagccaagtttggatttatt
gtcatggattacaatggcgctgtgtttgggaccttgagtggcaatacaagagaagtgctt
cacaagttcgttgtatatcttccaaagaaata |