Detail of Probeset Mtr.31304.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.31304.1.S1_at
Species Medicago truncatula
Annotation AJ502635 /FEA=mRNA /DEF=similar to UP|Q672P8 (Q672P8) Histidine triad family protein precursor, partial (45%)
Mapped public sequence ID AJ502635
Gene Ontology GO:0000166 GO:0003674 GO:0005634 GO:0005737 GO:0005829 GO:0008150 GO:0009117 GO:0016787 GO:0043530
KEGG K02503
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database AJ502635  
Target sequence tactcctccatcagtaagtgattcttaataggtggtagctgcaatg