| Detail of Probeset Mtr.31325.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31325.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
AJ503523 /FEA=mRNA /DEF=homologue to UP|PRS7_SPIOL (Q41365) 26S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA-ATPase subunit RPT1) (Regulatory particle triple-A ATPase subunit 1), partial (29%) |
| Mapped public sequence ID |
AJ503523 |
| Gene Ontology |
GO:0005515 GO:0005524 GO:0005634 GO:0005737 GO:0017111 GO:0030163 GO:0045335 |
| KEGG |
K03061 |
| Transporter |
3.A.16.1.1 3.A.16.1.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gggaacacacagagtttggttttcaacatctcaaaacaaactctagaatcgtaaatttga
atggctattgaccat |
