Detail of Probeset Mtr.31446.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.31446.1.S1_at |
Species |
Medicago truncatula |
Annotation |
AJ848534 /FEA=mRNA /DEF=similar to UP|O80814 (O80814) T8F5.21 protein, partial (9%) |
Mapped public sequence ID |
AJ848534 |
Gene Ontology |
GO:0004842 GO:0005515 GO:0005634 GO:0005829 GO:0008270 GO:0016567 GO:0030435 GO:0043161 |
KEGG |
K01931 K10690 K24041 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
AJ848534 |
Target sequence |
accatggtgaaaggactggcggtttctacgcttgcaat |