| Detail of Probeset Mtr.31446.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31446.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
AJ848534 /FEA=mRNA /DEF=similar to UP|O80814 (O80814) T8F5.21 protein, partial (9%) |
| Mapped public sequence ID |
AJ848534 |
| Gene Ontology |
GO:0004842 GO:0005515 GO:0005634 GO:0005829 GO:0008270 GO:0016567 GO:0030435 GO:0043161 |
| KEGG |
K01931 K10690 K24041 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AJ848534 |
| Target sequence |
accatggtgaaaggactggcggtttctacgcttgcaatcgttatgaagcagctaaacaag
agggggtgtatgatgaaactgaaaaaagaagagaaatggcaaagaattcattggagaggt
acttttt |
