| Detail of Probeset Mtr.31458.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31458.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AL365973 /FEA=mRNA /DEF=similar to UP|Q8H6N2 (Q8H6N2) S-adenosyl-L-methionine:salicylic acid methyltransferase, partial (9%) |
| Mapped public sequence ID |
AL365973 |
| Gene Ontology |
GO:0005739 GO:0006874 GO:0006883 GO:0009651 GO:0010447 GO:0015078 GO:0015992 GO:0000221 GO:0008553 |
| KEGG |
K02145 |
| Transporter |
3.A.2 3.A.2.2.3 3.A.2.3.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BQ144151 AL365973
TCMT41323 |
| Target sequence |
gtttggctttttgatatagttgtatgtgtagctatagtcttgtcattcagtcaccttggc
ttttgtccctagagaataatagacgaaacatctttc |