Detail of Probeset Mtr.31723.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.31723.1.S1_at
Species Medicago truncatula
Annotation AL377008 /FEA=mRNA /DEF=homologue to GB|AAM61286.1|21536945|AY084712 seven in absentia-like protein {Arabidopsis thaliana;} , partial (26%)
Mapped public sequence ID AL377008
Gene Ontology GO:0004842 GO:0005515 GO:0005769 GO:0007141 GO:0007283 GO:0008021 GO:0009791 GO:0040014 GO:0042787
KEGG K04506 K08742
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT59727  EY477939  
Target sequence tctctctcaagttctgacaaccgttagatttcaatcaaacggtcagtacttcctgtcaac
aagaacaaaggtg