Detail of Probeset Mtr.31737.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.31737.1.S1_at |
Species |
Medicago truncatula |
Annotation |
AL377677 /FEA=mRNA /DEF=similar to UP|Q7XAC2 (Q7XAC2) Peptide transporter 2 (Fragment), partial (47%) |
Mapped public sequence ID |
AL377677 |
Gene Ontology |
GO:0005290 GO:0005427 GO:0005765 GO:0015817 GO:0030163 |
KEGG |
K03305 |
Transporter |
2.A.17 2.A.17.3.2 2.A.17.3.3 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
AL377677 |
Target sequence |
tatagaagagtatgcatgtaacgctagaaacaaaattgaacacacatctttcttgagaat
ccttgacaaagc |