| Detail of Probeset Mtr.31833.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.31833.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL382300 /FEA=mRNA /DEF=weakly similar to UP|ASF1_HELAN (P22357) Anther-specific protein SF18 precursor (Fragment), partial (16%) |
| Mapped public sequence ID | AL382300 |
| Gene Ontology | GO:0003674 GO:0005829 GO:0005840 GO:0006414 GO:0022627 GO:0045182 GO:0000462 GO:0003735 GO:0006450 |
| KEGG | K02973 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | BQ143889 AL382300 TCMT40302 BQ143754 BG588987 |
| Target sequence | attgttatgaattatgcttcctcagactaaatgagttctatggacgattttgtatctgtt |