| Detail of Probeset Mtr.31895.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.31895.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
AL384504 /FEA=mRNA /DEF=similar to UP|O04249 (O04249) H(+)/hexose cotransporter (STP7 protein), partial (10%) |
| Mapped public sequence ID |
AL384504 |
| Gene Ontology |
GO:0005355 GO:0005887 GO:0008643 GO:0015519 GO:0015753 GO:0015758 GO:0016020 GO:0051119 |
| KEGG |
K03444 K08139 |
| Transporter |
2.A.1 2.A.1.1 2.A.1.1.1 2.A.1.1.14 2.A.1.1.4 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AL384504 |
| Target sequence |
cagagttggtcatggctatctgcatgcctgcattccagattctgaccggtataaactcaa
ttctcttttatgctccaatgctatttcaaagcatgggattaggcagacaagcatcgcttt
actcctcagccttgactggcgtagttcttgccttatcaacat |
