| Detail of Probeset Mtr.31921.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.31921.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL385688 /FEA=mRNA /DEF=similar to UP|Q8GRK9 (Q8GRK9) Transport protein particle component Bet3-like protein, partial (34%) |
| Mapped public sequence ID | AL385688 |
| Gene Ontology | GO:0000139 GO:0003674 GO:0005515 GO:0005575 GO:0005829 GO:0006888 GO:0008150 GO:0030008 |
| KEGG | K16614 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT43373 AL385688 EV259217 |
| Target sequence | tatcaaggtctatactactgcaacatattaagtggagtcattagaggagccttagatatg |