| Detail of Probeset Mtr.31947.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.31947.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL386714 /FEA=mRNA /DEF=weakly similar to UP|Q39224 (Q39224) SRG1 protein (F6I1.30/F6I1.30) (At1g17020/F6I1.30), partial (12%) |
| Mapped public sequence ID | AL386714 |
| Gene Ontology | GO:0008152 GO:0016491 |
| KEGG | K05277 K05278 K06892 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT43332 AL386714 TCMT43331 BQ165326 |
| Target sequence | aaatggatggttcttccgttgtcctggcgccttcagtccaagagttggaaaaacaaggaa |