| Detail of Probeset Mtr.31990.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.31990.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AL388165 /FEA=mRNA /DEF=homologue to UP|SARA_ARATH (O04834) GTP-binding protein SAR1A, partial (36%) |
| Mapped public sequence ID | AL388165 |
| Gene Ontology | GO:0003674 GO:0005575 GO:0006888 GO:0008150 GO:0016044 GO:0003924 GO:0005525 GO:0005813 GO:0006886 GO:0030127 GO:0045335 |
| KEGG | K07977 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO511712 TCMT42037 AL388165 TCMT42520 BQ152505 |
| Target sequence | ttggatgctctcctttctgatgaatcattggcaaatgtccctttccttgtccttggaaac |