| Detail of Probeset Mtr.32067.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.32067.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AW207976 /FEA=mRNA /DEF=homologue to UP|CG2B_MEDVA (P46278) G2/mitotic-specific cyclin 2 (B-like cyclin) (CycMs2), partial (15%) |
| Mapped public sequence ID | AW207976 |
| Gene Ontology | GO:0001701 GO:0005515 GO:0005624 GO:0005829 GO:0015630 GO:0040007 GO:0043029 GO:0048538 |
| KEGG | K05868 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS41154 BI270041 AW207976 |
| Target sequence | atggtgaatacttctgaagagaacaattccaacgcagttatgccaagaaaatttcaagga |