Detail of Probeset Mtr.32113.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.32113.1.S1_at
Species Medicago truncatula
Annotation AW329623 /FEA=mRNA /DEF=homologue to UP|PSNA_ARATH (O64668) Presenilin-like protein At1g08700, partial (11%)
Mapped public sequence ID AW329623
Gene Ontology GO:0000045 GO:0000186 GO:0001568 GO:0001708 GO:0001756 GO:0001764 GO:0001933 GO:0001934 GO:0001947 GO:0002244 GO:0002286 GO:0002573 GO:0004175 GO:0005515 GO:0005622 GO:0005624 GO:0005634 GO:0005640 GO:0005739 GO:0005783 GO:0005794 GO:0005886 GO:0006469 GO:0006486 GO:0006839 GO:0006874 GO:0006914 GO:0006915 GO:0006974 GO:0006979 GO:0007176 GO:0007219 GO:0007220 GO:0007420 GO:0007507 GO:0007611 GO:0007613 GO:0008013 GO:0009790 GO:0009791 GO:0015031 GO:0015813 GO:0015871 GO:0016020 GO:0016080 GO:0016337 GO:0021795 GO:0021870 GO:0021904 GO:0021987 GO:0022008 GO:0030182 GO:0030326 GO:0030424 GO:0030425 GO:0030426 GO:0030900 GO:0031410 GO:0032469 GO:0035253 GO:0035282 GO:0040011 GO:0042640 GO:0042987 GO:0043025 GO:0043065 GO:0043198 GO:0043227 GO:0043393 GO:0043406 GO:0044267 GO:0045296 GO:0045860 GO:0048167 GO:0048538 GO:0048666 GO:0048705 GO:0048854 GO:0050435 GO:0050673 GO:0050771 GO:0050820 GO:0050852 GO:0051402 GO:0051563 GO:0051604 GO:0051605 GO:0051966 GO:0060075 GO:0003674 GO:0005737 GO:0005938 GO:0006509 G
KEGG K04505 K06060
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database AW329623  
Target sequence gcacgaggtgttctacagtgttcttgtgggaagagctgcaatgtatgatcttatgactgt
ttatgcttgttaccttgccattatatctggacttggatgcactcttattttgttgtcggt
ttgtcgtcatgctttgccggctcttccgatttcgattgctttg