Detail of Probeset Mtr.32159.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.32159.1.S1_at |
Species |
Medicago truncatula |
Annotation |
AW683039 /FEA=mRNA /DEF=similar to UP|Q71BZ4 (Q71BZ4) Type-A response regulator, partial (21%) |
Mapped public sequence ID |
AW683039 |
Gene Ontology |
GO:0000155 GO:0000156 GO:0000160 |
KEGG |
K03413 K05971 K08282 K08857 |
Transporter |
|
Transcription Factor |
GARP-ARR-B C2C2-CO-like |
Mapped unigene in the TRICHOME database |
TCMT51787 |
Target sequence |
aaatctagactgtgatcagatattgatagtctcctatatttctccaattttgcaatacta
atgtccatattt |