| Detail of Probeset Mtr.32176.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.32176.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
AW683883 /FEA=mRNA /DEF=similar to UP|Q40223 (Q40223) Cyclin (Mitotic cyclin B1-1), partial (13%) |
| Mapped public sequence ID |
AW683883 |
| Gene Ontology |
GO:0000086 GO:0000092 GO:0000281 GO:0000775 GO:0000910 GO:0001700 GO:0005515 GO:0005737 GO:0005819 GO:0005829 GO:0007079 GO:0007141 GO:0007283 GO:0008608 GO:0009987 GO:0015630 GO:0016538 GO:0019908 GO:0045495 GO:0051233 |
| KEGG |
K05868 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AW683883 |
| Target sequence |
gcacgagcttgagaggagccctttttggactgatactctgaagcactacacaggctactc
tgaggaacaactaagggattgtgccaaactcatggcgagctttcattctgctgctccaga
gagtaggctaagggcaatttacaagaagttctgtagctctgatcgttgtgctgttgctct
tattgaactcccagcccaaaaa |