| Detail of Probeset Mtr.32250.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.32250.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | AW686208 /FEA=mRNA /DEF=similar to GB|AAL32012.1|16930693|AF436830 AT3g07810/F17A17_15 {Arabidopsis thaliana;} , partial (27%) |
| Mapped public sequence ID | AW686208 |
| Gene Ontology | GO:0003723 GO:0003727 GO:0005737 GO:0005739 GO:0005844 GO:0008150 GO:0008266 GO:0003730 GO:0005634 GO:0005849 GO:0006378 GO:0006379 GO:0040010 |
| KEGG | K12850 K13335 K18043 K24781 |
| Transporter | |
| Transcription Factor | C2H2 C3H |
| Mapped unigene in the TRICHOME database | AW686208 TCMT43516 EV261862 |
| Target sequence | gaagctattcattggagggatttcctgggatacaaatgaagaccgactcagacagtattt |